Tomato Marker Database

TES7228 Information

Marker name TES7228
Marker category EST-SSR
Primer sequences Fw gtggtggaaaaatccagcttc
Rv cgggtaaaagaggaaaagcc
EST/Genome sequences LEFL1044DD04
SSR Fragment size 295
Pattern* ATC(mis2)
Repeat count 5
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum