Tomato Marker Database

TES2527 Information

Marker name TES2527
Marker category EST-SSR
Primer sequences Fw gggacaccttatgcgtctgt
Rv aggccattaagttttattgacca
EST/Genome sequences FC04BE03
SSR Fragment size 280
Pattern* AT(mis2)
Repeat count 10
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum