| Marker name | TES2003 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | gcagaaccccacattgctttt | |
| Rv | accctcaacccacaacaatc | ||
| EST/Genome sequences | LEFL1003BC11 | ||
| Map | Expen2000 | Linkage | ch08 |
| Position | 101.413 | ||
| SSR | Fragment size | 235 | |
| Pattern* | AGC(mis1) | ||
| Repeat count | 5 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.