| Marker name | TES1816 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | gcatgaaaaagttggggaaaaa | |
| Rv | agccattgttgggttcttca | ||
| EST/Genome sequences | LEFL2044N18 | ||
| Map | Expen2000 | Linkage | ch07 |
| Position | 1.925 | ||
| AMF2 | Linkage | ch07 | |
| Position | 45.803 | ||
| SSR | Fragment size | 220 | |
| Pattern* | AAAT(mis1) | ||
| Repeat count | 4 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.