Tomato Marker Database

TES1805 Information

Marker name TES1805
Marker category EST-SSR
Primer sequences Fw gatgcaaattcaggggattca
Rv caaatgaaatcaaaatgcttcc
EST/Genome sequences LEFL1025DG05
Map Expen2000 Linkage ch06
Position 48.387
SSR Fragment size 223
Pattern* AAAT(mis1)
Repeat count 4
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum