Tomato Marker Database

TES1717 Information

Marker name TES1717
Marker category EST-SSR
Primer sequences Fw tgcatcaccgtggtcagtat
Rv gagcagttcccaactcgaac
EST/Genome sequences LEFL2007K22
SSR Fragment size 270
Pattern* AAG(mis1)
Repeat count 6
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum