Tomato Marker Database

TES1712 Information

Marker name TES1712
Marker category EST-SSR
Primer sequences Fw gtcacacacaggtaaaggggtt
Rv tccatgtgggtctgaaactg
EST/Genome sequences LEFL2001BB11
Map Expen2000 Linkage ch03
Position 49.845
SSR Fragment size 266
Pattern* AAG(mis1)
Repeat count 6
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum