Tomato Marker Database

TES1708 Information

Marker name TES1708
Marker category EST-SSR
Primer sequences Fw gcccatctctcccactatcca
Rv cggggaatgattttagagca
EST/Genome sequences LEFL1088BD10
Map Expen2000 Linkage ch07
Position 68.214
SSR Fragment size 240
Pattern* AG(mis1)
Repeat count 9
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum