Marker name | TES1349 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | GCCCCATAAAGTGGGGAAAAG | |
Rv | TTCGAATTCAAAAACCGGAG | ||
EST/Genome sequences | Singlet7631 | ||
Map | Expen2000 | Linkage | ch01 |
Position | 50.592 | ||
SSR | Fragment size | 174 | |
Pattern* | AGC(mis1) | ||
Repeat count | 6 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.