| Marker name | TES1180 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | gcgtcttcagacgtgtcttcg | |
| Rv | ccctttctctcattgttcttga | ||
| EST/Genome sequences | LEFL2041B22 | ||
| Map | Expen2000 | Linkage | ch04 |
| Position | 65.089 | ||
| AMF2 | Linkage | ch04 | |
| Position | 97.528 | ||
| SSR | Fragment size | 226 | |
| Pattern* | AAG(mis1) | ||
| Repeat count | 7 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.