Tomato Marker Database

TES1177 Information

Marker name TES1177
Marker category EST-SSR
Primer sequences Fw gtgcggaatggacaaagatt
Rv ttgcattcttgaacgacgac
EST/Genome sequences LEFL2032D24
Map Expen2000 Linkage ch10
Position 52.616
SSR Fragment size 204
Pattern* GGA(mis1)
Repeat count 7
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum