Tomato Marker Database

TES1157 Information

Marker name TES1157
Marker category EST-SSR
Primer sequences Fw gcatttccaaatccgcaaagt
Rv attttggaagtttctggggg
EST/Genome sequences LEFL1063DF02
Map Expen2000 Linkage ch09
Position 42.509
SSR Fragment size 286
Pattern* GGC(mis1)
Repeat count 7
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum