Tomato Marker Database

TES1139 Information

Marker name TES1139
Marker category EST-SSR
Primer sequences Fw gccaatttacacccaaaaaccc
Rv ttcttcttcaacccacccac
EST/Genome sequences LEFL1021AE11
Map Expen2000 Linkage ch03
Position 5.635
SSR Fragment size 297
Pattern* ATC(mis1)
Repeat count 7
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum