Tomato Marker Database

TES0861 Information

Marker name TES0861
Marker category EST-SSR
Primer sequences Fw gccatgacagacacgaccatc
Rv ccttttgcccgaacacaat
EST/Genome sequences LEFL2028G01
SSR Fragment size 184
Pattern* AAAT(mis1)
Repeat count 6
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum