Tomato Marker Database

TES0597 Information

Marker name TES0597
Marker category EST-SSR
Primer sequences Fw gggcaacgacaagtagcagt
Rv aattggattccttaaccggg
EST/Genome sequences LEFL2045D06
SSR Fragment size 99
Pattern* ACT(mis1)
Repeat count 11
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum