| Marker name | TES0449 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | gtctcatttgcttaatttcttctcc | |
| Rv | catccctcattgcatcactc | ||
| EST/Genome sequences | LEFL1039DA05 | ||
| Map | Expen2000 | Linkage | ch06 |
| Position | 37.884 | ||
| SSR | Fragment size | 238 | |
| Pattern* | AAG | ||
| Repeat count | 7 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.