Tomato Marker Database

TES0303 Information

Marker name TES0303
Marker category EST-SSR
Primer sequences Fw gtcttcttcttcttcttcttcttcttga
Rv cataccaagggaatgatggg
EST/Genome sequences LEFL2034O20
Map AMF2 Linkage ch01
Position 32.014
SSR Fragment size 94
Pattern* GGT
Repeat count 8
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum