Tomato Marker Database

TES0269 Information

Marker name TES0269
Marker category EST-SSR
Primer sequences Fw gccttttcttcttccccaggt
Rv attcgcagaagaatggcagt
EST/Genome sequences FC04DA12
Map Expen2000 Linkage ch05
Position 82.571
SSR Fragment size 206
Pattern* AG
Repeat count 12
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum