Tomato Marker Database

TES0140 Information

Marker name TES0140
Marker category EST-SSR
Primer sequences Fw gtccattaaaaggggcaaaaa
Rv aacgtgctctgttttctggg
EST/Genome sequences LEFL1037BD08
Map Expen2000 Linkage ch10
Position 50.359
SSR Fragment size 235
Pattern* AAG
Repeat count 9
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum