| Marker name | TES0096 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | GAGGCTAAGGCTGCCAATGTA | |
| Rv | TGGCAGATCCTATTCCCATC | ||
| EST/Genome sequences | Singlet6155 | ||
| Map | AMF2 | Linkage | ch04 |
| Position | 84.566 | ||
| SSR | Fragment size | 135 | |
| Pattern* | GGA | ||
| Repeat count | 9 | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.