| Marker name | TES0087 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | cctcattaaaagcccctcaa | |
| Rv | gttttgtgggcaacacaagg | ||
| EST/Genome sequences | LEFL1064BG09 | ||
| Map | Expen2000 | Linkage | ch04 |
| Position | 77.046 | ||
| AMF2 | Linkage | ch04 | |
| Position | 101.005 | ||
| SSR | Fragment size | 96 | |
| Pattern* | AAAT | ||
| Repeat count | 7 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.