Tomato Marker Database

TES0039 Information

Marker name TES0039
Marker category EST-SSR
Primer sequences Fw ccaggtccaaatttgcctaa
Rv gttgagggtaagaaaggggc
EST/Genome sequences LEFL1002AH04
Map Expen2000 Linkage ch01
Position 50.519
SSR Fragment size 253
Pattern* ATC
Repeat count 11
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum