| Marker name | TES0027 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | gaaacaacaagtgctgcatgg | |
| Rv | cttttccatttatcccgtaaaa | ||
| EST/Genome sequences | FC10CE03 | ||
| Map | Expen2000 | Linkage | ch12 |
| Position | 21.438 | ||
| AMF2 | Linkage | ch12 | |
| Position | 17.623 | ||
| SSR | Fragment size | 183 | |
| Pattern* | AAT | ||
| Repeat count | 12 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.