| Marker name | TEI0069 | ||
|---|---|---|---|
| Marker category | Intron-SNP | ||
| Primer sequences | Fw | TTGGCAGCTGACATGGGA | |
| Rv | CTCTTGTAACGTATCGTTGAACC | ||
| EST/Genome sequences | Contig21559_196_197 | ||
| Map | Expen2000 | Linkage | ch11 |
| Position | 94.553 | ||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.