Sub clover Marker Database

original sequence
>Tsud_sc01617.00_9636 SNP sequence
AGGAGTCACAAACCCTAAGTCTTCCATGTGCACGG[A/G]CTTTGACACTGATTTTTATC
CTCGGTGACCATGAT


MarkerDB | Trifolium subterraneum