Sub clover Marker Database

original sequence
>Tsud_sc01050.00_115310 SNP sequence
AGGAACAAGACAAGGAGCAGATATTGTGTGGTCAT[A/T]GTGAGAAATTAGCAGTAGTA
TTAGGACTAATCAAT


MarkerDB | Trifolium subterraneum