Sub clover Marker Database

original sequence
>Tsud_sc00865.00_8600 SNP sequence
ATGGTTGAAGCAGCAGATCATGATTTTTATTTACC[C/T]GATGAATGTTGGGAACTTGT
ATTCGAATTCCTCGT


MarkerDB | Trifolium subterraneum