Sub clover Marker Database

original sequence
>Tsud_sc00770.00_87173 SNP sequence
ACCGGAATCTTGTATTATCTGGTTTCTTAAGCATG[C/A]TTTCAAAATTTTAACAAGTC
ATGATTATGTCTACG


MarkerDB | Trifolium subterraneum