Sub clover Marker Database

original sequence
>Tsud_sc00618.00_145212 SNP sequence
ATATTTACACTACAAAAAATTAACTATTTTACCAC[C/G]GTCTATTAGCCACTGTTATT
TGGTCTGTGGGTAAA


MarkerDB | Trifolium subterraneum