Sub clover Marker Database

original sequence
>Tsud_sc00456.00_67305 SNP sequence
AACCTTGCTTCTCAGTTTCAGCTTTTCAGTACTAA[T/C]CCATCCCTTTGTATTTGCTT
TCACATTATGCAAGT


MarkerDB | Trifolium subterraneum