Sub clover Marker Database

original sequence
>Tsud_sc00291.10_92602 SNP sequence
GTTGATGCGAAATTAGATTACACTGATGAATTTCC[G/A]CTAAAAGAAATACTAACCGA
TCCATGTATTGCGTT


MarkerDB | Trifolium subterraneum