Sub clover Marker Database

original sequence
>Tsud_sc00147.00_759255 SNP sequence
TGTACTTCATGATCATGCTTGAATGTTTGAGAGTA[G/A]AGAAGTAGAATTCTTGGTTA
TACTCTGCTTTTTCA


MarkerDB | Trifolium subterraneum