Sub clover Marker Database

original sequence
>Tsud_sc00133.20_74849 SNP sequence
GTTGCTAGAAAGTACTTTCAACAGCTTATCAGCGC[A/C]GTTGATTTTTGCCACAGCCG
CGGTGTCACACACCG


MarkerDB | Trifolium subterraneum