Sub clover Marker Database

original sequence
>Tsud_sc00091.00_300091 SNP sequence
TCAATTCTAAGGCAATTCTCCAACACTTATAATGA[C/T]TGCCTCGACTGAAAAAACCA
TATTGCTTGCATAGT


MarkerDB | Trifolium subterraneum