Marker name | RosCOS1308 | ||
---|---|---|---|
Marker category | Other-SSR | ||
Primer sequences | Fw | ACTCTGCTGGCTTTGTTCCT | |
Rv | GGCTCTGCATGTTTAGTGAGG | ||
EST/Genome sequences | |||
Lines | |||
PIC | Value | ||
Lines | |||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | RosCOS Cabrera et al. (2009) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.