Soybean Marker Database

original sequence
>TC230101 TC230101
CACACCAGACCCTTCTCTTCCAACAAAATCAGTGAGGATCTGAGAAGAAGAAGCATTGGC
CAGAGGCATGACTGCAAGGGGCAGCGACCCCATAAGGGGTCGTCTTCGGCCGCAAATGGC
CTTGGCCTTGGCCATTGCTTTGATTTCTATCACTTTGGTTTCCGTTAATGCTGATGGTTA
CCCTTACTATTCCCCTCCTCCACCTTACCAGTACACCTCACCACCTCCTCCTCCTTACCT
CTACAAGTCTCCTCCCCCACCCTCTCCTTCACCTCCTCCTCCATACTATTATAAATCTCC
ACCACCACCCTCTCCCTCACCTCCACCCCCTTATTATTATAAGTCTCCACCACCACCTTC
ACCATCTCCTCCACCACCCTATTATTACAAGTCTCCACCTCCACCTGAAAAGTCTCCCGC
TCCAACTCCCTACTACTATAAGTCTCCACCACCACCTTCTCCATCTCCTCCACCACCCTA
CTATTACAAGTCTCCTCCACCACCATCTCCCTCACCCCCCCCACCTTACTATTACAAGGC
TCCTCCTCCACCATCTGCCTCACCTCCACCTGCTTATTATTACAAGTCTCCACCACCACC
TTCACCATCCCCTACACCACCTTACTATTACAAGACTGCGCCACCACCTTCTCCTTCCCC
TCCACCACCCTACTATTACAAGTCTCCGCCACCACCTGAAAAGCCTCCAGCTCCAACTCC
TTACTACAATAAGTCTCCTCCTCCTCCATCACCAACTCCTTACTATTACAAGTCTCCACC
AACTCCCTCTCCAACTCCGTACTACTATAAGTCTGCTCCTCCGCCGCCACCTTATTACTA
CAAGTCTGCACCCACACCATCCGCAGCTCCTTACTACTACGAGTCTCCACCCCCACCACC
ACCTTATTACTACAAGTCTCCTCCCCCACCACCTTACTATTACA


MarkerDB | Glycine max