Soybean Marker Database

original sequence
>TC204062 TC204062
GCCATAATCTCTCTCACCTTGCCATCTCAAACATTATCAGACAACTACATCTACTCATCT
CCACCACCACCAAAGCACTCACCTCCTCCTCCATATTATTATCACTCTCCACCACCACCG
AAGCACTCACCTCCTCCTCCCTACTACTACAAGTCCCCACCACCGCCACCTAAGAAGCCC
TACAAATACCCATCCCCTCCACCACCAGTTTACAAGTACAAGTCTCCTCCTCCTCCCTAC
AAGTACCCATCTCCTCCACCTCCCCCATACAAGTACCCATCTCCACCACCCCCAGTCTAC
AAGTACAAGTCTCCACCACCCCCAGTTTACAAGTACAAATCTCCCCCTCCTCCTTACAAG
TACCCATCTCCTCCTCCTCCTCCATACAAGTACCCTTCTCCTCCACCACCAGTTTATAAA
TACAAATCTCCTCCTCCACCAGTCTACAAATACAAGTCTCCACCTCCTCCATACAAGTAC
CCATCTCCACCACCTCCACCCTACAAGTACCCATCTCCTCCACCCCCAGTTTACAAGTAC
AAGTCTCCTCCTCCTCCTGTTCATTCACCACCTCCACCACACTACATCTATGCATCCCCT
CCTCCTCCATATCACTACTAGATAGTGGTTTTGCTTAGCTTCCCGAGTAGTTATTAATGA
AGAATATAAGCCAATAAAGAACGTTGTTGAAGAGATGAATACACATGTCTTATTTTGGTT
TC


MarkerDB | Glycine max