Red clover Marker Database

original sequence
>BB922102 BB922102  RCE28365
gtggaataaacttttatttgtattgaacaatagtaacaaagccaagtatcctcaaattca
attatgttgaggagattgacattaaagttggaccatatgtacaaaaagcacctaccactt
ttgggtggggaacaagtagtaggtcttaagtagacccattttaactaataataatttaca
attttacatatataattcaaagaccaatcaataatttacactgcataaggattagagtaa
tcacggattcctcctgctccttcccatccagaccattcttcccaaaagtcataatctggt
tcttcataggtataggtctcacaggtttcttgtgcatttgtttcttcttctctcaaattt
gtcatcacaacatcataagcctcattgattaggtgaaactgcacaccacaatctcttcct
ctgcacacatctggatggtactgcaaagcaagctttctaaaagctttcctaacatcagat
tcagaagcacctggttcaactctcaatgtcttataaggatccataacagaagcagaatta
gagcaagaaaccctaaatttgttcatcttattt


MarkerDB | Trifolium pratense