| Marker name | RCS4416 | ||
|---|---|---|---|
| Marker category | Red_clover_SSR | ||
| Primer sequences | Fw | TCAGCTTTGAATCCTGACCC | |
| Rv | ATGGCCGGAGAGAAGAAAGT | ||
| EST/Genome sequences | BB907476 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map (HR x R130) |
Linkage | LG3 | |
| Position | 70.099 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 240 | |
| Pattern* | AAAC | ||
| Repeat count | 16 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | RCS4416 | ||
| Enzyme | |||
| Related markers | Marker name | AP006419 | |
| Species | Lotus japonicus | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.