Red clover Marker Database

Marker List

Total Entries: 7785

Show rows.

Marker Name Marker Type Primer(Fw) Primer(Rv)
RCS0715 Red_clover_SSR CGATGTGGGACTTAAACACTCA GCAGGTTGTGGTGGTCTCAT
RCS0716 Red_clover_SSR CCTCCTCCTCCTCCTCCTTA TTCGTGTCCTGTTTGTCGTC
RCS0717 Red_clover_SSR TACACCTGGAGGAGGTGGAG GCCACCTATCCGAAGATTGT
RCS0718 Red_clover_SSR TTTCAGATTCCCCGAATCAC CTGCATTGCACTCATTGCTC
RCS0719 Red_clover_SSR TTCCGGTCAACACTGTACCA TGTTGTTGTTGTTGGGTGAA
RCS0720 Red_clover_SSR TGATGATAAAGTCATACAACATCTAGC CATTGACACTATTAATGATAAAGTTGC
RCS0721 Red_clover_SSR CAAAACCATCCAGCCATTG GCTTGAAGTAAGGGGAGTGG
RCS0722 Red_clover_SSR TCAATCAACCCTGAGAAGTCAA TCCTCCGACGAGTTTGTAATG
RCS0723 Red_clover_SSR CGACGGTGAAGATGATGAAA CCGGAAATCAAAGCTCAACA
RCS0724 Red_clover_SSR TCCTCTTTCTCTCTCTCCGAAA GAAAATGATGAGAATGGAGGAG
RCS0725 Red_clover_SSR GACGACGACGAAGAAGGAGA TGTTCTTCATCCAATTTGTTCATC
RCS0726 Red_clover_SSR CCTCTTCATCCTCTATCTCCTCCT GTGGTGGTGGTGGTGGTG
RCS0727 Red_clover_SSR CTTGGAGAAGGCAATTGTGG TGACCGTCATCCAGTAACCA
RCS0728 Red_clover_SSR CTAAGCTTGCCGATCTTCCA TGTTGTGTTTGGGGTTTTTG
RCS0729 Red_clover_SSR GGTACACGAATCGAAGGGAAT CCCCAATTCGTAATTGTTCC
RCS0730 Red_clover_SSR TTCATAACCACATGTCAACACA CGAGGTAAGGGCACCTTTTT
RCS0731 Red_clover_SSR CCCCTTCAGGATTTTTCTCC GCCCTTGAGGAGGAGAGGTA
RCS0732 Red_clover_SSR CACTGTAACAGAGCAATTCACCA TTGGATGGAAGGAATTTTCG
RCS0733 Red_clover_SSR CTTCACCTTCACCTTCACTCG ATCGAAGGTGAGGACGGTTT
RCS0734 Red_clover_SSR CCTCCTCCTCCTCCTCCTC TGATAGGAAATTTATATGGAAATGG
RCS0735 Red_clover_SSR GCGTTGCGTCCTTCTAATTC CCCCCTCTCTCTCTCTCTCTC
RCS0736 Red_clover_SSR ATGCCAAATATGGTGGAGGT CCACCCCCATTATTATAACCAC
RCS0737 Red_clover_SSR TCCCAAATCCTCCTCACAAC TTGTTCGAACGGTGTTGTTC
RCS0738 Red_clover_SSR GCCTCTGGCAATGATTGAGT AGGTAAGGGCGCTGTTGTTA
RCS0739 Red_clover_SSR GCCTTCAACTTCTTCAAAGCAC TCTTTCATTGGCAAGTGTGG
RCS0740 Red_clover_SSR TCCATTGTTGCGTGATCTTC CGCAAGAACGTGAGGTACAA
RCS0741 Red_clover_SSR TTGTTCTCGAATTTGGCAAG CCAATGCCACCTCCAATC
RCS0742 Red_clover_SSR GccACCACCACCACCATATAC GTGGGATTGAACCTGTTCGT
RCS0743 Red_clover_SSR GCTTCGACCATGCTCTTCTC TGGGTCATTGCAAGCTTATG
RCS0744 Red_clover_SSR ACCACCCACACCAACACC GTTGGTGGAGTGATCACAGG
RCS0745 Red_clover_SSR GGTGAGTATGGACCGTATTCTTG TCCCATAATCTGCAGCCATA
RCS0746 Red_clover_SSR CATGTGGGGTGGTGGATTAT CTCATCAACACGAAGCCTCA
RCS0747 Red_clover_SSR GTACCGAATGCGGGAGTAGA AACTTTCAATCAGCCAATTTTCA
RCS0748 Red_clover_SSR GGAGGAGTTCTATTACCACCAGT CGAGGTTCTGGTGTGGTTTC
RCS0749 Red_clover_SSR TGGATCAAGCAAAAGAGCAa TAAGGGGGTGAAAGGGAGAT
RCS0750 Red_clover_SSR TTCTGGGAATTCCATCTCGT AACCTCCAACAAAAATCTTCTTTC
RCS0751 Red_clover_SSR CCCTTTTCCATGCTCAATGT TCACATACCTCGCATCATTCA
RCS0752 Red_clover_SSR CCTCATTGTATTTTCTCTCCAACC GACTCGGGACTTAAGCGGTA
RCS0753 Red_clover_SSR CCTCTTCATCCTCTATCTCCTCCT TTGTTTGGTTTCTTCAACTGTGA
RCS0754 Red_clover_SSR TCGCGATAAGATGAGAAAGGA TCATCTCAAAGAAAAATCCATCAA
RCS0755 Red_clover_SSR TTTGTAGGCCAGTGTCTGGA ACCCTCTGCAGGAGGAATTT
RCS0756 Red_clover_SSR GACGACGACGAAGAAGGAGA TTGTTCTTCATCCAACTTGTTCA
RCS0757 Red_clover_SSR GCTATGAATGAAACCAACGCTAT TTGTTTTGGAGTGACGTGGA
RCS0758 Red_clover_SSR TCAAATTTCAGTTCATATACATTTCA TTAGTGCGCATAATTGACCA
RCS0759 Red_clover_SSR TAACTCCCTCCACCAAGTCG GAGTTCAATCTGGCCCTGTT
RCS0760 Red_clover_SSR TGGAACAGGTGGTAAAGATGG CTCCCTCATTCTCTCGCAAA
RCS0761 Red_clover_SSR TTGAAGAACAGGGAAAATTGC TGGATTCTGTTGGTCTTGAAA
RCS0762 Red_clover_SSR TGCACACCGTAGAAGACACC TTGTTCATTGATGCCTTGGT
RCS0763 Red_clover_SSR GTGCCAGTGTCCTCCATCTT GGGGGATAGAGGGCTGATAG
RCS0764 Red_clover_SSR TCACAAAAATTATCTTCATCTTCTCTC ACGACCCTTTGCAAGTCTGA

Total Entries: 7785

Go to page.
Total pages: 156

MarkerDB | Trifolium pratense