Red clover Marker Database

Marker List

Total Entries: 7785

Show rows.

Marker Name Marker Type Primer(Fw) Primer(Rv)
RCS7115 Red_clover_SSR ATGGGTGTGCTCTAATCCCA GCAAAAATCTGCTTGCTGTG
RCS7116 Red_clover_SSR ACCTCCCTTTCTTCCTCCAA GGTTCCGCTTGATTGATGTT
RCS7117 Red_clover_SSR TTGCGACATTAAATCAGCCA GCAGGACAAGGGACAAAAGA
RCS7118 Red_clover_SSR TCGAGTGTATTTGGCAGGAA CCAACTCTTTGCAATTGTTCA
RCS7119 Red_clover_SSR CCAGCAAAAGGTTTCATCCA TTTTGTTTCAAGTTTGGGCA
RCS7120 Red_clover_SSR TGGCCTATAAAGTCGTCGCT CGCCCTAATGAACTTGGTGT
RCS7121 Red_clover_SSR TGATCCCAAGACATGGACAA GCATTTTTAGCTCGCTTTGG
RCS7122 Red_clover_SSR ATCTTGCTGGTTTGATCCCA CAATCACAAAAATGAGGGCA
RCS7123 Red_clover_SSR GAAATGCCAAGGTTGAGGAA GGAAAAAGGAAGGGATTGGA
RCS7124 Red_clover_SSR ACCAAAGAATCTGCACACCC CATTGAAGGCTGGGTGATCT
RCS7125 Red_clover_SSR TCCTCAAACGTGAAGATCCC TGCAAAGCTTGAAGTCGAAA
RCS7126 Red_clover_SSR CCCGCCATAACATTGCTAGT GTTGGTGCAATCCAATGATG
RCS7127 Red_clover_SSR TGGATCAACAACAACAGCATC ATTTCCGGCTAGGTTGAGGT
RCS7128 Red_clover_SSR CTGTGGTTCCTCAACCCACT CCAACCAAGGTTTGGACATC
RCS7129 Red_clover_SSR CCACGCTTCATCTTGTGCTA CTGCAATTGGTCATCAGCTC
RCS7130 Red_clover_SSR TTTCCTGGAATCAGCAGGTC GTGCAATCCGGGTACATTTC
RCS7131 Red_clover_SSR GACTTGCAATTCGCAGTCAC TATTGGACCAAACCCGAAAA
RCS7132 Red_clover_SSR GCTGTTGCCCAAGTTCTCTC GCAAGGCAATCTGCATTTTT
RCS7133 Red_clover_SSR CCAACAACTCGAAATCCACA TATGGGAAAACGTGAGGAGG
RCS7134 Red_clover_SSR ATGATGGCAACGGTGGTAAT TTTGTTTTGCACTTCACCCTC
RCS7135 Red_clover_SSR TTCTAGAAGCATAACGCGCC AGGCTTCAGCAAGAACTGGA
RCS7136 Red_clover_SSR TTCAATTCACCGTTCAACCA ACGACGGTTTTCACAGCTTC
RCS7137 Red_clover_SSR CACAGCTAAACCACCAGAGTGA TGACAACAAAGGAACCCACA
RCS7138 Red_clover_SSR GGACCCGGCTGTTATTTGTA ATGAATTGGAAAAAGCGGGT
RCS7139 Red_clover_SSR TGCAAATGGCACTTTTGTTA AGCAGCAGCCTTCTTTTCTG
RCS7140 Red_clover_SSR CCCTGTCCTCAGGTTTGTGT ACGGCCAATGATGAAGAAAC
RCS7141 Red_clover_SSR CCAAAACCACTTTCCTTCCA TACGGTACGCTTTCAAACCC
RCS7142 Red_clover_SSR CGCTACTATGCTGCCCTAGC CTGCTATTGTTTCCGCCTTC
RCS7143 Red_clover_SSR TACCGCGTAAGCAAGCTACA GCGGGAGTTTTTCTCTTTCC
RCS7144 Red_clover_SSR TGGCGAATGTAGCAGCTATG TTGGTTCTGGAAATTCGGAG
RCS7145 Red_clover_SSR GGGCTGCAGTGTTTTGAGAC AGGAAGGTTTTGCTTCGGAT
RCS7146 Red_clover_SSR TGCAAAATTTGTCTCCCCTC CACTGTTGCCTCCAGCATAA
RCS7147 Red_clover_SSR ACCACCCTCAGTGGTACTGG AAGATCACCAACACAACCGC
RCS7148 Red_clover_SSR CGTGGTCACCGGATCTTTAT GACGGAGTAGTTACGGTGGC
RCS7149 Red_clover_SSR AAGGCAAGGCTAAGGGTGAT TCAAAATGTGAAATCGACAACA
RCS7150 Red_clover_SSR AGAACCCTCTGCAGATTCAA AACTGCACCGTCGAGTTCTT
RCS7151 Red_clover_SSR TTGCAGTATGCAGCCTTTCA AACCAGTTTATAGGAGCGTGG
RCS7152 Red_clover_SSR TAAGCCTCCAATGCCAAATC GCACTTAAACATGGGGGCta
RCS7153 Red_clover_SSR TCACCCTTCATGCATAAAACT AGCATCAGGGTGTGAAAGGT
RCS7154 Red_clover_SSR TTGATGGGGCATTTTTCTTC TCTTGGCATCCAAATTCCTC
RCS7155 Red_clover_SSR TGAAACACCAGGATCGTGAC AGAAGATCATGCCCATAGCC
RCS7156 Red_clover_SSR TCCGCGTTTCCTTTCATTAC TGAATCCACTTTTGCGTGTC
RCS7157 Red_clover_SSR TCAAACTTTGGTCCCCACAT GAGGGGAATCAAGTTGCTCA
RCS7158 Red_clover_SSR TGACACATTTTGTGTGTCCAAA AATCAACAACCTGGCCAAAA
RCS7159 Red_clover_SSR TTCTCTCCTACCTATTATCCATCCC CTCCCAAAATAGCGGTGAAG
RCS7160 Red_clover_SSR ATCACGGGAGTCTTTTGTGG CTGAAATGGTTGGTCCCAGT
RCS7161 Red_clover_SSR CAGTTGGCTTAGGTGCTTCC GTAGTGACCAAAAGTGGCGG
RCS7162 Red_clover_SSR CACACAAAATTGCCTTTGGA TTTGAGATCGCAGAAGTGGA
RCS7163 Red_clover_SSR AGCAAGAGTAGGCTGTGGGA TCTGTTCCATTTGTCACCCA
RCS7164 Red_clover_SSR CACCAAAATCTTGCCCACTT GCTGCTCCATGATGCTACTG

Total Entries: 7785

Go to page.
Total pages: 156

MarkerDB | Trifolium pratense