Red clover Marker Database

Marker List

Total Entries: 7785

Show rows.

Marker Name Marker Type Primer(Fw) Primer(Rv)
RCS7065 Red_clover_SSR GATGATCAATGCTCAAATGGC AGAAGGTGTTCCCAAAGCAA
RCS7066 Red_clover_SSR TGTATTTATCCCGATATCCTTCC GGTATTCGCTAATATTGAAAGAATCTA
RCS7067 Red_clover_SSR CCCAGAACCAGCTGATGAAT CCACTGCAGAAAGGAAAAGG
RCS7068 Red_clover_SSR ACTCCATTTGGCAGAACCAC TATCATGTTGGTGGCCATGT
RCS7069 Red_clover_SSR ATATATTTAAACTTTTTGTTGCATCCT GGAAGAGAAACTGGCACAGC
RCS7070 Red_clover_SSR ACAATTTCTATCCAAGATGACACA GGAAGTGAATGCGAGGAAAC
RCS7071 Red_clover_SSR ATAGCTCCCTTCTGTTGCCA TAAGCTGGCATGGATTTTCC
RCS7072 Red_clover_SSR TGCGGATGATTTGTCCATAA TTTTGAAGGGAAGGTGTGGT
RCS7073 Red_clover_SSR CTTGCCACACCTCCAAACTT GTAGTGACCAAAAGTGGCGG
RCS7074 Red_clover_SSR AAGGAGCCTCCACTAGCTCC ctAGGGTATGCCGGTCGTTA
RCS7075 Red_clover_SSR CAATTCAAAATAATCAACTTCCTCAA AGGTGAAGGAAGTGCCAATG
RCS7076 Red_clover_SSR TCTTCCTCCACCACCACAAC TGCTGTTGCTGTTCCTCCTA
RCS7077 Red_clover_SSR TTTCATCATTTGGCAGTTCG GCAATGTTGCGGAATTTCTT
RCS7078 Red_clover_SSR CTATCGTTGCTCCTTCCCAC TGATTCCAGACCACTCACGA
RCS7079 Red_clover_SSR GAGCATCATGTCCTTCCCAT CTGATGTGTACATGGAGAGTGTTG
RCS7080 Red_clover_SSR CCGAAGGAAAATTCTAAAACCC CACGGTTATTGCTCGAACCT
RCS7081 Red_clover_SSR CGGACTTTGCCCAAATACAC TGAAGAAGCATATTTGTCGGC
RCS7082 Red_clover_SSR ACAAGGACCAAAAACATCGC TCAAGGCATGGCAGTAATGA
RCS7083 Red_clover_SSR GCGTTTCATGCAATTTGTTG AAAGGGTGGAAAATCATCTCA
RCS7084 Red_clover_SSR TTTATACCCGAGGCTTGTCG ATATTCGACCGGGAGGAAGT
RCS7085 Red_clover_SSR CAAATGCTGAAATGGCCTTC TCCACCACTTCAACCCTCTC
RCS7086 Red_clover_SSR CTTCACCTGGTGGGATAAGG GGAAGCTCGATTCAAAGCTG
RCS7087 Red_clover_SSR GCAAATTCCAAACATAACCTCTG TTGGATGGAATTGGAGAGAA
RCS7088 Red_clover_SSR TTCATTGTTCTTTCCACCAAAA ATTTGGGTTTGTTCCATTGC
RCS7089 Red_clover_SSR CACCGTTGCCTACTTAGAATCA TGTCAGCTGAAGCAAGCAGT
RCS7090 Red_clover_SSR GAACTTTTGTTTTGGGGCAA GCCATGTGAGGTCTTTTGCT
RCS7091 Red_clover_SSR GGGAGCAGCAGTCTCATTTC GACGGTTCCACAGGCTAATG
RCS7092 Red_clover_SSR TTCGTACTTCCAGACTGGGG TATCACCGGAAGCAAAATCC
RCS7093 Red_clover_SSR TGTATGGTCCTCACTGTGCC TGTGTTCTCCCTCCAAGACA
RCS7094 Red_clover_SSR TGTGTTACCACACGCCAGTT ATTACTGAGGGACGGGCTTT
RCS7095 Red_clover_SSR TGCAGCAATACTTGAAGCTGA TTTGCTTTTTGGACCCAATC
RCS7096 Red_clover_SSR AACGATCCAGAGCAACCAAC ATCGGCAAAATTAATCGCAG
RCS7097 Red_clover_SSR GGAGAGGGTTATGGGGGATA CCCTCGGGAATACCAAAGAT
RCS7098 Red_clover_SSR CCAAATATTTCCTTCGGTCG TGCAATGGAAGATGGTGAGA
RCS7099 Red_clover_SSR TTATCAAAAGCACCCCCAAC TGCCAAGCTTCAAGAACAAA
RCS7100 Red_clover_SSR ACCATGCTTGCCAAACTTTC GTGCATCTGGTCACAATGCT
RCS7101 Red_clover_SSR CATGCAAAATTCTGTTGTCAGAT AATGCGTGTCTGAATGCAAG
RCS7102 Red_clover_SSR TCGGCATTATTTTACCTGCC GGATCCAAGCAAGATCGGTA
RCS7103 Red_clover_SSR TTGAATGGCAAAGGGAATCT GGGCAAGGATTCATGTCTGT
RCS7104 Red_clover_SSR TCCTGGTCTTGTTCATGCTG AACATCAACCACCCCAGTTC
RCS7105 Red_clover_SSR ATCAGAGTTACCGGACACCG CGATCGAATTGCAGAGAGGT
RCS7106 Red_clover_SSR AAGATCTCATCGGCATCACC TCCTATCCCTCGCATGACTC
RCS7107 Red_clover_SSR TGCCATTTGTACCACATGCT CTTGCTGGCACAGAAGACAT
RCS7108 Red_clover_SSR CAAAGGTTTGAATGGATGGG AAACTCTTCCTCTCttcTCTCACG
RCS7109 Red_clover_SSR TCTTTCCAAACACTCCCCAC TTTGGCAGCCTCTTTAGTTGA
RCS7110 Red_clover_SSR TTTGACGACAAAGACACCCA GCAGTGGCGTTACAGTTGAA
RCS7111 Red_clover_SSR AATAATGTAAGCTCATGTCAATATGTC CTCAAATTGGAAGCCAAGGA
RCS7112 Red_clover_SSR ACGCTGTGTAAGCAAGCAAA CCATGGTTTAAGAGGCATCA
RCS7113 Red_clover_SSR CTCAGCAAACAAGTCCATGC TGCAGGATAGCAGAGTCCCT
RCS7114 Red_clover_SSR TTCAACTTCAGTAGCATCAATGG ACTCCTTTTTGTGGACACGG

Total Entries: 7785

Go to page.
Total pages: 156

MarkerDB | Trifolium pratense