Marker name | TC42A02 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | AGAAATTGTGGAAATGAAGGGA | |
Rv | CACTTACAGAGCTGTTTTCGCT | ||
EST/Genome sequences | JN887635 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | BF6 | Linkage | BB06 |
Position | 15.401 | ||
TF6 | Linkage | TA06 | |
Position | 18.386 | ||
Integrated consensus map | Linkage | B06 | |
Position | 83.268 | ||
Integrated consensus map | Linkage | A06 | |
Position | 18.387 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Macedo et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.