Marker name | TC41C11 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | CACCAGAAAACATGAGAGCAAA | |
Rv | CATCCACCTTCGTGTTAACCTC | ||
EST/Genome sequences | JN887632 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA06 |
Position | 48.696 | ||
BF6 | Linkage | BB01 | |
Position | 11.486 | ||
TF6 | Linkage | TA06 | |
Position | 73.344 | ||
Integrated consensus map | Linkage | B01 | |
Position | 42.11 | ||
Integrated consensus map | Linkage | A03 | |
Position | 107.334 | ||
Integrated consensus map | Linkage | A06 | |
Position | 74.221 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Macedo et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.