| Marker name | TC3H07 | ||
|---|---|---|---|
| Marker category | Publicly available markers | ||
| Primer sequences | Fw | CAATGGGAGGCAAATCAAGT | |
| Rv | GCCAAATGGTTCCTTCTCAA | ||
| EST/Genome sequences | DQ099193 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | SKF2 | Linkage | LG06.2 |
| Position | 25.998 | ||
| NYF2 | Linkage | LG06.2 | |
| Position | 71.561 | ||
| AF5 | Linkage | AA06 | |
| Position | 9.157 | ||
| TF6 | Linkage | TA06 | |
| Position | 29.931 | ||
| TF6 | Linkage | TB06 | |
| Position | 21.315 | ||
| Integrated consensus map | Linkage | B06 | |
| Position | 69.897 | ||
| Integrated consensus map | Linkage | A06 | |
| Position | 36.922 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Moretzsohn et al. (2005) ABS0312 |
||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.