Marker name | TC3H07 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | CAATGGGAGGCAAATCAAGT | |
Rv | GCCAAATGGTTCCTTCTCAA | ||
EST/Genome sequences | DQ099193 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG06.2 |
Position | 25.998 | ||
NYF2 | Linkage | LG06.2 | |
Position | 71.561 | ||
AF5 | Linkage | AA06 | |
Position | 9.157 | ||
TF6 | Linkage | TA06 | |
Position | 29.931 | ||
TF6 | Linkage | TB06 | |
Position | 21.315 | ||
Integrated consensus map | Linkage | A06 | |
Position | 36.922 | ||
Integrated consensus map | Linkage | B06 | |
Position | 69.897 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Moretzsohn et al. (2005) ABS0312 |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.