Peanut Marker Database

TC1A08 Information

Marker name TC1A08
Marker category Publicly available markers
Primer sequences Fw AAGGGGTTAAGGGCATGACT
Rv CCACAAATGGGTCGTCGAT
EST/Genome sequences DQ099213
Lines
PIC Value
Lines
Map AF5 Linkage AA02
Position 30.735
Integrated consensus map Linkage B01
Position 45.64
Integrated consensus map Linkage A02
Position 51.165
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0278

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea