Marker name | Seq4H06 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | CCAACATTGCAGAAGCAAGA | |
Rv | CAAAGAGAGGCACACCACAA | ||
EST/Genome sequences | Seq4H06 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA06 |
Position | 12.658 | ||
BF6 | Linkage | BB06 | |
Position | 11.436 | ||
TF6 | Linkage | TA06 | |
Position | 42.672 | ||
Integrated consensus map | Linkage | A06 | |
Position | 41.88 | ||
Integrated consensus map | Linkage | B06 | |
Position | 79.609 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Moretzsohn et al. (2005) ABS0631 |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.