| Marker name | Seq4A06 | ||
|---|---|---|---|
| Marker category | Publicly available markers | ||
| Primer sequences | Fw | CGCTTGCCCCACTACACTAT | |
| Rv | AGCAGTGCTTTGCATGTACG | ||
| EST/Genome sequences | CC000369 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | BF6 | Linkage | BB01 |
| Position | 9.759 | ||
| TF6 | Linkage | TA01 | |
| Position | 58.445 | ||
| TF6 | Linkage | TB01 | |
| Position | 44.556 | ||
| Integrated consensus map | Linkage | B01 | |
| Position | 46.35 | ||
| Integrated consensus map | Linkage | A01 | |
| Position | 88.848 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Ferguson et al. (2004) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.