Marker name | AhTE0371 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | GCTGAATCCTCTTCTGCCAC | |
Rv | CCAGAAACCGTTTTGCTGTAT | ||
EST/Genome sequences | AhTE8i04J12 | ||
Lines | 8 | ||
PIC | Value | ||
Lines | |||
Map | NYF2 | Linkage | LG02.1 |
Position | 36.311 | ||
AF5 | Linkage | AA07 | |
Position | 6.488 | ||
TF6 | Linkage | TB02 | |
Position | 21.286 | ||
TF6 | Linkage | TA02 | |
Position | 53.997 | ||
Integrated consensus map | Linkage | A02 | |
Position | 46.15 | ||
Integrated consensus map | Linkage | A07 | |
Position | 66.115 | ||
Integrated consensus map | Linkage | B02 | |
Position | 61.406 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 435 | |
Pattern* | |||
Repeat count | |||
Method | PCR | 58 | |
Detection | |||
Multiplex | |||
Gel image | image4119.jpg,image8141.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.