Peanut Marker Database

AhTE0360 Information

Marker name AhTE0360
Marker category Transposable Element
Primer sequences Fw GGATATGATGCCCATAGCTGA
Rv TGCTGACTACTTGCAATGCC
EST/Genome sequences AhTE8i02P05
Lines 8
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 56.871
TF6 Linkage TA03
Position 95.912
Integrated consensus map Linkage B03
Position 134.048
Integrated consensus map Linkage A03
Position 134.818
SNP Position
Method
SSR Fragment size 374
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4117.jpg,image8092.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea